View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1166_high_74 (Length: 240)

Name: NF1166_high_74
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1166_high_74
NF1166_high_74
[»] chr3 (1 HSPs)
chr3 (1-217)||(37315822-37316038)
[»] chr1 (8 HSPs)
chr1 (128-216)||(16175108-16175196)
chr1 (128-216)||(16184166-16184254)
chr1 (128-216)||(16223556-16223644)
chr1 (128-213)||(33109266-33109351)
chr1 (122-204)||(30615885-30615967)
chr1 (128-217)||(33115301-33115390)
chr1 (122-217)||(30620623-30620718)
chr1 (1-30)||(16175294-16175323)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 37316038 - 37315822
Alignment:
1 ctttggttggcttggggacaaaatgggaagnnnnnnngtttatggtctaactcttgcccttatggtattctcttctcttgcttctggcctttcttttggt 100  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37316038 ctttggttggcttggggacaaaatgggaagaaaaaaagtttatggtctaactcttgcccttatggtattctcttctcttgcttctggcctttcttttggt 37315939  T
101 cactcagcaaagggtacaattggaactctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
37315938 cactcagcaaagggtacaattggaactctttgtttctttagattctggctaggttttggtattggtggtgattaccctctttcagctactattatgtctg 37315839  T
201 aatatgctaacaaaaag 217  Q
    ||||||| |||||||||    
37315838 aatatgccaacaaaaag 37315822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 16175196 - 16175108
Alignment:
128 ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaa 216  Q
    |||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||    
16175196 ctttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctacaatcatgtctgaatatgctaacaaaaa 16175108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 16184166 - 16184254
Alignment:
128 ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaa 216  Q
    |||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||    
16184166 ctttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctacaatcatgtctgaatatgctaacaaaaa 16184254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 16223556 - 16223644
Alignment:
128 ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaa 216  Q
    |||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||    
16223556 ctttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctacaatcatgtctgaatatgctaacaaaaa 16223644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 213
Target Start/End: Original strand, 33109266 - 33109351
Alignment:
128 ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaa 213  Q
    ||||||||||| || |||||||| |||||||| || |||||||||||||||||||| ||||| ||||||||||| ||||| |||||    
33109266 ctttgtttcttcaggttttggcttggttttggaattggtggtgattaccctctttctgctacaattatgtctgagtatgcgaacaa 33109351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 204
Target Start/End: Complemental strand, 30615967 - 30615885
Alignment:
122 ggaactctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaata 204  Q
    ||||||||||| ||||| ||||| ||||| ||||||||||| ||||||||||| || ||||| ||||| ||||||||||||||    
30615967 ggaactctttgcttcttcagattctggcttggttttggtattggtggtgattatccactttctgctacaattatgtctgaata 30615885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 217
Target Start/End: Original strand, 33115301 - 33115390
Alignment:
128 ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaag 217  Q
    ||||||||||| || || ||||| || ||||| || || |||||||||||||||||||||||||| |||||||| ||||| || ||||||    
33115301 ctttgtttcttcaggttctggcttggatttggaattggcggtgattaccctctttcagctactatcatgtctgagtatgcaaataaaaag 33115390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 122 - 217
Target Start/End: Complemental strand, 30620718 - 30620623
Alignment:
122 ggaactctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaag 217  Q
    ||||||||||| ||||| ||||| ||||| ||||| ||||| ||||| ||||| || ||||| || || ||||||||||||||  | |||||||||    
30620718 ggaactctttgcttcttcagattctggcttggtttcggtattggtggagattatccactttctgcaacaattatgtctgaatactcgaacaaaaag 30620623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 16175323 - 16175294
Alignment:
1 ctttggttggcttggggacaaaatgggaag 30  Q
    ||||||||||||||||||||||||||||||    
16175323 ctttggttggcttggggacaaaatgggaag 16175294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University