View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_high_74 (Length: 240)
Name: NF1166_high_74
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_high_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 37316038 - 37315822
Alignment:
| Q |
1 |
ctttggttggcttggggacaaaatgggaagnnnnnnngtttatggtctaactcttgcccttatggtattctcttctcttgcttctggcctttcttttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37316038 |
ctttggttggcttggggacaaaatgggaagaaaaaaagtttatggtctaactcttgcccttatggtattctcttctcttgcttctggcctttcttttggt |
37315939 |
T |
 |
| Q |
101 |
cactcagcaaagggtacaattggaactctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37315938 |
cactcagcaaagggtacaattggaactctttgtttctttagattctggctaggttttggtattggtggtgattaccctctttcagctactattatgtctg |
37315839 |
T |
 |
| Q |
201 |
aatatgctaacaaaaag |
217 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
37315838 |
aatatgccaacaaaaag |
37315822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 16175196 - 16175108
Alignment:
| Q |
128 |
ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaa |
216 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16175196 |
ctttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctacaatcatgtctgaatatgctaacaaaaa |
16175108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 16184166 - 16184254
Alignment:
| Q |
128 |
ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaa |
216 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16184166 |
ctttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctacaatcatgtctgaatatgctaacaaaaa |
16184254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 16223556 - 16223644
Alignment:
| Q |
128 |
ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaa |
216 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16223556 |
ctttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctacaatcatgtctgaatatgctaacaaaaa |
16223644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 213
Target Start/End: Original strand, 33109266 - 33109351
Alignment:
| Q |
128 |
ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaa |
213 |
Q |
| |
|
||||||||||| || |||||||| |||||||| || |||||||||||||||||||| ||||| ||||||||||| ||||| ||||| |
|
|
| T |
33109266 |
ctttgtttcttcaggttttggcttggttttggaattggtggtgattaccctctttctgctacaattatgtctgagtatgcgaacaa |
33109351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 204
Target Start/End: Complemental strand, 30615967 - 30615885
Alignment:
| Q |
122 |
ggaactctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaata |
204 |
Q |
| |
|
||||||||||| ||||| ||||| ||||| ||||||||||| ||||||||||| || ||||| ||||| |||||||||||||| |
|
|
| T |
30615967 |
ggaactctttgcttcttcagattctggcttggttttggtattggtggtgattatccactttctgctacaattatgtctgaata |
30615885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 217
Target Start/End: Original strand, 33115301 - 33115390
Alignment:
| Q |
128 |
ctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaag |
217 |
Q |
| |
|
||||||||||| || || ||||| || ||||| || || |||||||||||||||||||||||||| |||||||| ||||| || |||||| |
|
|
| T |
33115301 |
ctttgtttcttcaggttctggcttggatttggaattggcggtgattaccctctttcagctactatcatgtctgagtatgcaaataaaaag |
33115390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 122 - 217
Target Start/End: Complemental strand, 30620718 - 30620623
Alignment:
| Q |
122 |
ggaactctttgtttctttagattttggctaggttttggtataggtggtgattaccctctttcagctactattatgtctgaatatgctaacaaaaag |
217 |
Q |
| |
|
||||||||||| ||||| ||||| ||||| ||||| ||||| ||||| ||||| || ||||| || || |||||||||||||| | ||||||||| |
|
|
| T |
30620718 |
ggaactctttgcttcttcagattctggcttggtttcggtattggtggagattatccactttctgcaacaattatgtctgaatactcgaacaaaaag |
30620623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 16175323 - 16175294
Alignment:
| Q |
1 |
ctttggttggcttggggacaaaatgggaag |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16175323 |
ctttggttggcttggggacaaaatgggaag |
16175294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University