View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_33 (Length: 392)
Name: NF1166_low_33
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 30 - 341
Target Start/End: Original strand, 31111803 - 31112114
Alignment:
| Q |
30 |
agaatgcgtgtctcgctcaagtagaagaaaatcaatataaaatttctgctgcaaatgtgacttaaattaaggtcgttcaacgaaatcaacaaaccgccac |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111803 |
agaatgcgtgtctcactcaagtagaagaaaatcaatataaaatttctgctgcaaatgtgacttaaattaaggtcgttcaacgaaatcaacaaaccgccac |
31111902 |
T |
 |
| Q |
130 |
tccaatgaatgtggtagaaaatgttgcttctgagaaagatgaaaatcaggatccatggcacaaagttccttcttctcctcgttgcggaggatctcctttg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31111903 |
tccaatgaatgtggtagaaaatgttgcttctgagaaagatgaaaatcaggatccatggcacaaagttcctttttctcctcgttgcggaggatctcctttg |
31112002 |
T |
 |
| Q |
230 |
cacgattcagacggaggcgtaagcagtcacactccttcatcccgtgagagacctaaaaaatcccctcttatcattacagtccnnnnnnnggaaacactcc |
329 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31112003 |
cacgattcagacggaggcgtaagcggtcacactccttcatcccgtgagagacctaaaaaatcccctcttatcattacagtccaaaaaaaggaaacactcc |
31112102 |
T |
 |
| Q |
330 |
taaaatatatcg |
341 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31112103 |
taaaatatatcg |
31112114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University