View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_39 (Length: 361)
Name: NF1166_low_39
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 65 - 250
Target Start/End: Original strand, 41103885 - 41104070
Alignment:
| Q |
65 |
acatcatcgcggattgtagactcttaacggctttaagatagcgtttggcttcttgacgagtgttggtgaaaagagaattagaatggttagaagaagtaga |
164 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103885 |
acatcatagcggattgtagactcttaacggctttaagatagcgtttggcttcttgacgagtgttggtgaaaagagaattagaatggttagaagaagtaga |
41103984 |
T |
 |
| Q |
165 |
gacagtgttccatttggttataagagtgcgtgcggtttctatgttttcatcaactattgcgtctgagaatgttttgttctgtggtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41103985 |
gacagtgttccatttggttataagagtgcgtgcggtttctatgttttcatcaactattgcgtctgagaatgttttgttttgtggtg |
41104070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University