View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_52 (Length: 320)
Name: NF1166_low_52
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 103 - 307
Target Start/End: Original strand, 42450200 - 42450402
Alignment:
| Q |
103 |
tgttccaaatcagtcaactaggcgtgttcaagtttgatggtttagcaattgagcttatgaatttcatattaaaaattaggtaatatgtggaaagattgac |
202 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42450200 |
tgttccaaatcagttaactaggcgtgttcaagtttgatggtttagcaattgagcttatgaatttcatattaaaaattaggtaatatgtggaaagattgac |
42450299 |
T |
 |
| Q |
203 |
atgtttttctttaatatattggaagcgaaacacatatttttctttcagtcttgtttctgaaacatgcacagatacagttgccatatgtgattagccttac |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42450300 |
atgtttttctttaatatattggaagcgaaacacatatttttc--tcagtcttgtttctgaaacatgcacagacacagttgccatatgtgattagccttac |
42450397 |
T |
 |
| Q |
303 |
tccct |
307 |
Q |
| |
|
||||| |
|
|
| T |
42450398 |
tccct |
42450402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 172
Target Start/End: Original strand, 42263426 - 42263463
Alignment:
| Q |
136 |
ttgatggtttagcaattgagcttatg-aatttcatatt |
172 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42263426 |
ttgatggtttagcaattgagcttatgaaatttcatatt |
42263463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University