View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_53 (Length: 317)
Name: NF1166_low_53
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_53 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 95 - 317
Target Start/End: Complemental strand, 41234666 - 41234446
Alignment:
| Q |
95 |
actttggatagtagcatcaaacaatttaactcactcttatcttctctacctctcttcatgtctaggcaagaagtacaagaatatagttgagattttttat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
41234666 |
actttggatagtagcatcaaacaatttaactcactcttatcttctctacctctcttcatgtctaggaaaaaagtacaagaatatagttgagattttttat |
41234567 |
T |
 |
| Q |
195 |
ggaacgggcttagtatatattgtacaaattaataatgagaatttgagagcattacacacttatagattatatagattatagataggttctcagcatatgt |
294 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41234566 |
ggaactggcttagtatat--tgtacaaattaataatgagaatttgagagcattacacacttatagattatatagattatagataggttctcagcatatgt |
41234469 |
T |
 |
| Q |
295 |
gaggaaggtgcgtatagatagat |
317 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41234468 |
gaggaaggtgcgtatagatagat |
41234446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University