View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_67 (Length: 268)
Name: NF1166_low_67
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_67 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 32 - 268
Target Start/End: Original strand, 28070537 - 28070773
Alignment:
| Q |
32 |
ataggtaccaattgcctatttaatttttcatatttatacatattgaaaattttctatggaaaagagttttttaacactgtttactttaaaatggttttta |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28070537 |
ataggtaccaattgcctatttaatttttcatatttatacatattgaaaattttctatggaaaagagttttttaacactgtttactttaaaatggttttta |
28070636 |
T |
 |
| Q |
132 |
gaacaattttctggaatgaaggatttgtatgattgtgtttagtttcagcatagagagagcaacaagtgatttgaagctaggatttgtatagtttttggct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28070637 |
gaacaattttctggaatgaaggatttgtatgattgtgtttagtttcagcatagagagagcaacaagtgatttgaagctaggatttgtatagtttttggct |
28070736 |
T |
 |
| Q |
232 |
tcaagcatgattttcacacgcaaatgtattgttcaac |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28070737 |
tcaagcatgattttcacacgcaaatgtattgttcaac |
28070773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University