View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_75 (Length: 252)
Name: NF1166_low_75
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 13 - 207
Target Start/End: Original strand, 30652005 - 30652200
Alignment:
| Q |
13 |
attctacatcattttattaattct-acttccccattcgccatcatatggttcaatggatgcatgaatatcgaaagtgaagaaatgaaagaagatacattc |
111 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
30652005 |
attctacatcattttattaaggcttacttccccattcgccgtcatatggttcaatggatgcatgaatatcaaaagtgaagaaatggaagaagatacattc |
30652104 |
T |
|
| Q |
112 |
attaacttattgaagattgatatcatttgtcacattgtgcttaattttggcgcttcaggtttgatttcaagaagtgttttaataacttaggatgaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30652105 |
attaacttattgaagattgatatcatttgtcacattgtgcttaattttggcgcttcaggtttgatttcaagtagtgttttaataacttaggatgaa |
30652200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University