View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1166_low_78 (Length: 251)

Name: NF1166_low_78
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1166_low_78
NF1166_low_78
[»] chr2 (1 HSPs)
chr2 (1-244)||(44738107-44738349)


Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 44738107 - 44738349
Alignment:
1 aaacactttgacaatgactttgtgtcagaatctacaattgtttgtttatattttatgattctttttatatttaaaggaaaatgctaatatatgtgtttta 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44738107 aaacactttgacaatgactttgtgtcagaatctacaattatttgtttatattttatgattctttttatatttaaaggaaaatgctaatatatgtgtttta 44738206  T
101 aggaaataaaatagtgaatcaaatatagaaaatttgagtgatgagaattgtacattcaacttcnnnnnnnagtttagatttgttaaaaacattgatacta 200  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||    
44738207 aggaaataaaata-tgaatcaaatatagaaaatttgagtgatgagaattgtacattcaacttctttttttagtttagatttgttaaaaacattgatacta 44738305  T
201 cttttggaggaggcaaattttattatagaaatgcagaattatct 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
44738306 cttttggaggaggcaaattttattatagaaatgcagaattatct 44738349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University