View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_78 (Length: 251)
Name: NF1166_low_78
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 44738107 - 44738349
Alignment:
| Q |
1 |
aaacactttgacaatgactttgtgtcagaatctacaattgtttgtttatattttatgattctttttatatttaaaggaaaatgctaatatatgtgtttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44738107 |
aaacactttgacaatgactttgtgtcagaatctacaattatttgtttatattttatgattctttttatatttaaaggaaaatgctaatatatgtgtttta |
44738206 |
T |
 |
| Q |
101 |
aggaaataaaatagtgaatcaaatatagaaaatttgagtgatgagaattgtacattcaacttcnnnnnnnagtttagatttgttaaaaacattgatacta |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44738207 |
aggaaataaaata-tgaatcaaatatagaaaatttgagtgatgagaattgtacattcaacttctttttttagtttagatttgttaaaaacattgatacta |
44738305 |
T |
 |
| Q |
201 |
cttttggaggaggcaaattttattatagaaatgcagaattatct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44738306 |
cttttggaggaggcaaattttattatagaaatgcagaattatct |
44738349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University