View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_low_89 (Length: 202)
Name: NF1166_low_89
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_low_89 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 32157920 - 32158030
Alignment:
| Q |
1 |
acttcgctggtaaacaatttagtaagtatccctatcaatagtttatgaatcttgagacgtgctccgattctgatgagcccccaagacctaactcatctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32157920 |
acttcgctggtaaacaatttagtaagtatccctatcaatagtttatgaatcttgagacgtgctccgattctgatgagcccccaagacctaactcatctac |
32158019 |
T |
|
| Q |
101 |
ttatgaagaag |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
32158020 |
ttatgaagaag |
32158030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University