View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11670_high_4 (Length: 229)
Name: NF11670_high_4
Description: NF11670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11670_high_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 43234343 - 43234562
Alignment:
| Q |
7 |
caaatcgagtcccatgataacaatattgaaatggatagagcacacatatgcaaagggaccatacattgccacttacaaaatccatttttatattgtgatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43234343 |
caaatcgagtcccatgataacaatattgaaatggatagagcacacatatgcaaagggaccatacattgccacttacaaaatccatttttatattgtgatg |
43234442 |
T |
 |
| Q |
107 |
ttgtcacacccataaacatcaaagagaatgagttagtttcagtagagacccttgcagtttcttagatgtgatatgtgccacttagatatatttggtaatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43234443 |
ttgtcacacccataaacatcaaagagaatgagttagtttcagtagagacccttgcagtttcttagatgtgatatgtgccacttagatatatttgg---tt |
43234539 |
T |
 |
| Q |
207 |
agttagttcaaaatcaacatata |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43234540 |
agttagttcaaaatcaacatata |
43234562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University