View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11671_high_12 (Length: 313)
Name: NF11671_high_12
Description: NF11671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11671_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 16 - 306
Target Start/End: Complemental strand, 25531251 - 25530961
Alignment:
| Q |
16 |
aataattagcagtaataataacaacttattattaccattcgagaacacccttgagttttcaatggattcgcgaaatccttgcgaagatttcaaagaatct |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25531251 |
aataattagcagcaataataacaacttattattaccattcaagaacacccttgaggtttcaatggattcgcgaaatccttgcgaagatttcaaagaatct |
25531152 |
T |
 |
| Q |
116 |
attgtggaaatggtggaggcttatggtattaacgattgggaaaccctagaaaagcttttgagttggtattttgaagttaatgagaaaagaaatcatggat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25531151 |
attgtggaaatggtggaggcttatggtattaacgattgggaaaccctagaaaagcttttgagttggtattttgaagttaatgagaaaagaaatcatggat |
25531052 |
T |
 |
| Q |
216 |
ttattattgatgcnnnnnnngatttatttgttagatttgctcatagttcaccaaattgttctcctttatctattcatagttgttcttctct |
306 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25531051 |
ttattattgatgctttttttgatttatttgttagatttgatcatggttcaccaaattgttctcctttatctattcatagttgttcttctct |
25530961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University