View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11671_high_13 (Length: 287)
Name: NF11671_high_13
Description: NF11671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11671_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 272
Target Start/End: Original strand, 11174351 - 11174612
Alignment:
| Q |
11 |
tgaaattgacaggcaagtcccaaggaggagttgaacctaagctcacacctcccatataagggcattgaatctcagaattgacttcagagttagcagcaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11174351 |
tgaaattgacaggcaagtcccaaggaggagttgaacctaagctcacacctcccatataagggcattgaacctcagaattgacttcagagttagcagcaga |
11174450 |
T |
 |
| Q |
111 |
tgatctcagtcctcttttgtaggaactggtggatccttttgtgcaaacatctttaaacttcagtacaatatcctttatctgcatgtgcacaaaaatataa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11174451 |
tgatctcagtcctcttttgtaggaactggtggatccttttgtgcaaacacctttaaacttcagtacaatatcctttatctgcatgtgcacaaaaatataa |
11174550 |
T |
 |
| Q |
211 |
gacattcatattagcatttatgcattagaagtttgaataatgtaaccattgtatgaagaatc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11174551 |
gacattcatattagcatttatgcattagaagtttgaataatgtaaccattgtatgaagaatc |
11174612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University