View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11671_high_18 (Length: 249)
Name: NF11671_high_18
Description: NF11671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11671_high_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 26784574 - 26784333
Alignment:
| Q |
8 |
tagcaaaggcaggcattattgcttccctcaatgcaaggacctcggtgttggcttgcgcaaaccctagtgggtcacgatataatccccgcttgtctgtcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26784574 |
tagcaaaggcaggcattattgcttccctcaatgcaaggacctcggtgttggcttgcgcaaaccctagtgggtcacgatataatccccgcttgtctgtcat |
26784475 |
T |
|
| Q |
108 |
tgacaacatacaccttcctcccactcttttgtccaggttagttgttggacataagccgtgataactaggttatggatctggctatgtatttatgcaattc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26784474 |
tgacaacatacaccttcctcccactcttttgtccaggttagttgttggacataagccgtgataactaggttatggatctggctacgtatttatgcaattc |
26784375 |
T |
|
| Q |
208 |
ctcatgcattggcagcaatccattttataccttgggccttac |
249 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26784374 |
ctcatgcattggcagcaatcaattttataccttgggccttac |
26784333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University