View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11671_high_23 (Length: 240)
Name: NF11671_high_23
Description: NF11671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11671_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 26784271 - 26784047
Alignment:
| Q |
1 |
ttatcaaacctagtgtgggtaggggttggcataaagcaaaaaattctctttaaaaataaatggaagctac--gacagttttgcaagtgttgctattgatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26784271 |
ttatcaaacctagtgtgggtaggggttggcataaagcaaaaaattctctttaaaaataa-tggaagctactagacagttttgcaagtgttgctattgatt |
26784173 |
T |
 |
| Q |
99 |
taagttgatctttttcctggcagatttgatttaatttacttaatgcttgataaggctgatgaacagaccgaccgacgacttgccaaacatattgtttccc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26784172 |
taagttgatctttttcctggcagatttgatttaatttacttaatgcttgataaggctgatgaacagaccgaccgacgacttgccaaacatattgtttccc |
26784073 |
T |
 |
| Q |
199 |
tgcactataaggattatgaggtctgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26784072 |
tgcactataaggattatgaggtctgt |
26784047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University