View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11671_low_15 (Length: 281)
Name: NF11671_low_15
Description: NF11671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11671_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 38947767 - 38947508
Alignment:
| Q |
1 |
acatggtagatcaagttgaggcagatttattaaccggtggcgccttcggcttcaccggagaagtagtgacatcaggtggggcagcaaactcagctttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38947767 |
acatggtagatcaagttgaggcagatttattaaccggtggcgccttcggcttcaccggagaagtagtgacagcaggtggggcagcaaactcagctttgat |
38947668 |
T |
 |
| Q |
101 |
ctcttggttggtgttgtgctgagcaatggtggatcttgtggctccattggtggatgattgaacttgaaggttgttggtattgggtggagtcaagtcaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38947667 |
ctcttggttggtgttgtgctgagcaatggtggatcttgtggctccattggtggatgattgagcttcaaggttgttggtattgggtggagtcaagtcaaat |
38947568 |
T |
 |
| Q |
201 |
ggtttggtgaagatatcagcagcaaatatctcagatggaatggcttgagaaggtgtgcgt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38947567 |
ggtttggtgaagatatcagcagcaaatatctcagatggaatggcttgagaaggtgtgcgt |
38947508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 38941848 - 38941597
Alignment:
| Q |
1 |
acatggtagatcaagttgaggcagatttattaaccggtggcgccttcggcttcaccggagaagtagtgacatcaggtggggcagcaaactcagctttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38941848 |
acatggtagatcaagttgaggcagatttattaaccggtggcgccttcggcttcaccggagaagtagtgacagcaggtggggcagcaaactcagctttgat |
38941749 |
T |
 |
| Q |
101 |
ctcttggttggtgttgtgctgagcaatggtggatcttgtggctccattggtggatgattgaacttgaaggttgttggtattgggtggagtcaagtcaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38941748 |
ctcttggttggtgttgtgctgagcaatggtggatcttgtggctccattggtggatgattgagcttcaaggttgttggtattgggtggagtcaagtcaaat |
38941649 |
T |
 |
| Q |
201 |
ggtttggtgaagatatcagcagcaaatatctcagatggaatggcttgagaag |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38941648 |
ggtttggtgaagatatcagcagcaaatatctcagatggaatggcttgagaag |
38941597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University