View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11671_low_19 (Length: 249)

Name: NF11671_low_19
Description: NF11671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11671_low_19
NF11671_low_19
[»] chr4 (1 HSPs)
chr4 (8-249)||(26784333-26784574)


Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 26784574 - 26784333
Alignment:
8 tagcaaaggcaggcattattgcttccctcaatgcaaggacctcggtgttggcttgcgcaaaccctagtgggtcacgatataatccccgcttgtctgtcat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26784574 tagcaaaggcaggcattattgcttccctcaatgcaaggacctcggtgttggcttgcgcaaaccctagtgggtcacgatataatccccgcttgtctgtcat 26784475  T
108 tgacaacatacaccttcctcccactcttttgtccaggttagttgttggacataagccgtgataactaggttatggatctggctatgtatttatgcaattc 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
26784474 tgacaacatacaccttcctcccactcttttgtccaggttagttgttggacataagccgtgataactaggttatggatctggctacgtatttatgcaattc 26784375  T
208 ctcatgcattggcagcaatccattttataccttgggccttac 249  Q
    |||||||||||||||||||| |||||||||||||||||||||    
26784374 ctcatgcattggcagcaatcaattttataccttgggccttac 26784333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University