View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_high_13 (Length: 346)
Name: NF11672_high_13
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 7 - 331
Target Start/End: Original strand, 9171814 - 9172139
Alignment:
| Q |
7 |
gtgagaagaagtggaactttagtatctcatctacaatatttggatgatactttgtgccnnnnnnnntattcttaaacggattgttgtcacgctgttgctt |
106 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
9171814 |
gtgaaaagaagaggaactttagtatctcatctacaatatttggatgatactttgtgtcaaaaaaaaaattcttaaacggattgttgtcacgttgttgctt |
9171913 |
T |
|
| Q |
107 |
ctacttggtgttgtt-cctttcgttgtcattgttttcaccgccgcatttctcagtacaaaataccacctctgaacatgtcattgacgtcggcgcaaggga |
205 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9171914 |
ctacttggtgttgttgcctttcattgtcattgttttcaccgccgcatttctcagtacaaaataccacctctgaacgtgtcattgacgtcggcgcaaggga |
9172013 |
T |
|
| Q |
206 |
tttctgattcaggggagattcattagcaacgccgacgactttggtgcatggttcaacgaagctgttatagagaagctcgccgtagttgaagacttcgacg |
305 |
Q |
| |
|
||||||||| ||||||||||||| || ||||||||| || ||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9172014 |
tttctgatttaggggagattcatcagaaacgccgacaacattgatgccatgttcaacgacgctgttatagagaagctcgccgtagttgaagacttcgacg |
9172113 |
T |
|
| Q |
306 |
atgccactgaagtgagatgcagtttt |
331 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
9172114 |
atgccactgaagtgagatgcagtttt |
9172139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 62
Target Start/End: Complemental strand, 9159444 - 9159415
Alignment:
| Q |
33 |
tcatctacaatatttggatgatactttgtg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9159444 |
tcatctacaatatttggatgatactttgtg |
9159415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University