View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_high_14 (Length: 343)
Name: NF11672_high_14
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 305
Target Start/End: Complemental strand, 27642508 - 27642226
Alignment:
| Q |
19 |
ttttactggggaaggggctattggttgatttggcattctgtcatttgggtttttcggaaggcaagaaataagaagattttcaagaattcgcctagaggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27642508 |
ttttactggggaaggggctattggttgatttggcattctgtcatttgggtttttcggaaggcaagaaataagaagattttcaagaattcgcctagaggat |
27642409 |
T |
|
| Q |
119 |
gtgatgatattgtggttatattagtcgattaaaagcgagcccgtggttatattatgaatggaggtcggatccggggggattgtttgaataggcagtgatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27642408 |
gtgatgatattgtggttatattagtcgattaaaagcgagcccgtggttatattatgaatggaggtcggatccg-ggggattgtttgaataggcagtgatc |
27642310 |
T |
|
| Q |
219 |
aggcagaggcgtcaaggtgcagcagctacatctgtctactgttgttggctgtctggtgcggtgctgatgtgttccttttttgctctg |
305 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27642309 |
aggcagaggcgtcaaggt---gcagctacatctgtctactgttgttggctgtctggtgcggtgctgctgtgttccttttttgctctg |
27642226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University