View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_high_19 (Length: 305)
Name: NF11672_high_19
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 42319898 - 42320067
Alignment:
| Q |
1 |
ttcctaaaatcactttgggtctgttttgtttccatcaattttctcattccttgaatatatgctgcaaaaaatatggtttcatttttatataattttgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42319898 |
ttcctaaaatcactttgggtctgttttgttttcatgaattttctcattccttgaatatatgctgcaaaaaatatggtttgatttttatataattttgttg |
42319997 |
T |
 |
| Q |
101 |
ggtttcagatcatgttactgttagttttgcaagaagtggaggacctgggggtcagaatgtcaataaaggt |
170 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42319998 |
ggtttcagatcatgttactgtgagttttgcaagaagtggaggacctgggggtcagaatgtcaataaaggt |
42320067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 205 - 290
Target Start/End: Original strand, 42320104 - 42320189
Alignment:
| Q |
205 |
gttatagttactttcgttttgagttcctataattatttggaatttggttttttagtccttgtattcactttttaggttagtctgtg |
290 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42320104 |
gttatagttactatcgttttgagttcctataattatttggaatttagttttttagtccttgtattcactttttaggttagtctgtg |
42320189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University