View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_high_27 (Length: 247)
Name: NF11672_high_27
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 236
Target Start/End: Complemental strand, 5907116 - 5906890
Alignment:
| Q |
6 |
aggagcagagagttgcgaaaattgaagtaacaccagccagccaaaagaacatcccaaatttatgactcaaattgtggtttttcagttattgcaaggaaca |
105 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5907116 |
aggaccagatagttgcgaaaattgaagtaacaccagcca----aaagaacatcccaaatttatgactcaaattgtggtttttcagttattgctaggaaca |
5907021 |
T |
|
| Q |
106 |
tagaatattgtccgaataaaagattcatagattaagccaatgaaaattatgaagccttttaatgtttagatctatgtatagcttattgtgttgtgctggt |
205 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5907020 |
tagaatattgtccgtataaaagattcatagattaagccaatgaaaattatgaagccttttaatgtttagatctatgtataacttattgtgttgtgctggt |
5906921 |
T |
|
| Q |
206 |
ctcatgaaacttaaaattgacagcagattat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5906920 |
ctcatgaaacttaaaattgacagcagattat |
5906890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University