View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11672_high_27 (Length: 247)

Name: NF11672_high_27
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11672_high_27
NF11672_high_27
[»] chr1 (1 HSPs)
chr1 (6-236)||(5906890-5907116)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 236
Target Start/End: Complemental strand, 5907116 - 5906890
Alignment:
6 aggagcagagagttgcgaaaattgaagtaacaccagccagccaaaagaacatcccaaatttatgactcaaattgtggtttttcagttattgcaaggaaca 105  Q
    |||| |||| |||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
5907116 aggaccagatagttgcgaaaattgaagtaacaccagcca----aaagaacatcccaaatttatgactcaaattgtggtttttcagttattgctaggaaca 5907021  T
106 tagaatattgtccgaataaaagattcatagattaagccaatgaaaattatgaagccttttaatgtttagatctatgtatagcttattgtgttgtgctggt 205  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
5907020 tagaatattgtccgtataaaagattcatagattaagccaatgaaaattatgaagccttttaatgtttagatctatgtataacttattgtgttgtgctggt 5906921  T
206 ctcatgaaacttaaaattgacagcagattat 236  Q
    |||||||||||||||||||||||||||||||    
5906920 ctcatgaaacttaaaattgacagcagattat 5906890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University