View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_high_37 (Length: 211)
Name: NF11672_high_37
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 4745705 - 4745881
Alignment:
| Q |
17 |
aaaattgaactaccagagtgtgaaaatttgctcttgataaagaataagaatttcataccatgtatactatgatgacagactacaaatgtatgatttggcg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
4745705 |
aaaattgaactaccagagtgtgaaaatttgctcttgataaagaataagaatttcataccatgtatactatgatgaaagactgcaaatgtatgatttggcg |
4745804 |
T |
 |
| Q |
117 |
gtcagtagtgaggcaataattagattagcccctcattattatcatctggtatcaattaagctattaacctgcgactt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4745805 |
gtcagtagtgaggcaataattagattagcccctcattattatcatctggtatcaattaagctattaacatgcgactt |
4745881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 17 - 111
Target Start/End: Original strand, 4708083 - 4708177
Alignment:
| Q |
17 |
aaaattgaactaccagagtgtgaaaatttgctcttgataaagaataagaatttcataccatgtatactatgatgacagactacaaatgtatgatt |
111 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||| ||||||| | |||||||| ||| |||| |||||||| |
|
|
| T |
4708083 |
aaaattgaactacaagtgtgtgaaaatttgctcttgataaaggataagaatttcatactatgtatattgtgatgacaaacttcaaaagtatgatt |
4708177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University