View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_high_39 (Length: 209)
Name: NF11672_high_39
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 36 - 162
Target Start/End: Complemental strand, 14368699 - 14368573
Alignment:
| Q |
36 |
aacctggatcctctgaaatcagtccaactgaatttcaaccgttgaatctagctgcaacctagctcgaatccaacatattgaaatttggttggactgactg |
135 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14368699 |
aacctggatcatctaaaatcagtccaactgaatttcaaccgttgaatctagctgcaacctagctcgaatccaacatattgaaatttggttggactgactg |
14368600 |
T |
 |
| Q |
136 |
cacagaggatctagtgtagggtgataa |
162 |
Q |
| |
|
|||| ||||||||| |||||||||||| |
|
|
| T |
14368599 |
cacaaaggatctagggtagggtgataa |
14368573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University