View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_low_17 (Length: 328)
Name: NF11672_low_17
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 314
Target Start/End: Complemental strand, 33990330 - 33990035
Alignment:
| Q |
19 |
caaccacagttctcaaaaatgtcaactgtttttatataatctgcaagatgaaatatttgcacacnnnnnnngatcatagatagagctaggaaaatgtgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33990330 |
caaccacagttctcaaaaatgtcaactgtttttgtataatctgcaagatgaaatatttgcacacaaaaaaagatcatagatagagctaggaaaatgtgaa |
33990231 |
T |
 |
| Q |
119 |
gtatatataataccttttgcatgtttggtaggagcaatagctggggatgagtatgtaagaattgcattcaactgcgccatattagtttttgctgtatatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33990230 |
gtatatataataccttttgcatgtttggtaggagcaatagctggggatgagtatgtaagaattgcattcaactgcgccatattagtttttgctgtatatt |
33990131 |
T |
 |
| Q |
219 |
ttcagtcactcactcaccacctttttattatggttgtttggaccctcttgagatgctactgtttctcttctcgtgcatactgtttcagtttctgtc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33990130 |
ttcagtcactcactcaccacctttttattatggttgtttggaccctcttgagatgctactgtttctcttctcgtgcatactgtttctgtttctgtc |
33990035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University