View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_low_20 (Length: 263)
Name: NF11672_low_20
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 38625043 - 38625295
Alignment:
| Q |
1 |
ctctcccaactgagctatccccgcttgctgataattacttcacaaataacaatataacaaaacttaatatccttgttgtccttatccacatgaatcatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38625043 |
ctctcccaactgagctatccccgcttgttgataattccttcacaaacaacaatataacaaaacataatatccttgttgtccttatccacatgaatcctca |
38625142 |
T |
|
| Q |
101 |
tcacctaaaatatattttgtcttgaccaatgttgtagtaaaattgtacgaaacttagaagaagaaaattcacaaccagagcaactcttctcttgccagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625143 |
tcacctaaaatatattttgtcttgaccaatgttgtagtaaaattgtacgaaacttagaagaagtaaattcacaaccagagcaactcttctcttgccagat |
38625242 |
T |
|
| Q |
201 |
ctttaacacaacaatgggaggaggttcttatttccagaacgagtttacctttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625243 |
ctttaacacaacaatgggaggaggttcttatttccagaacgagtttacctttg |
38625295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 31547833 - 31547801
Alignment:
| Q |
1 |
ctctcccaactgagctatccccgcttgctgata |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
31547833 |
ctctcccaactgagctatccccgcttggtgata |
31547801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 31877260 - 31877292
Alignment:
| Q |
1 |
ctctcccaactgagctatccccgcttgctgata |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
31877260 |
ctctcccaactgagctatccccgcttgatgata |
31877292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University