View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_low_22 (Length: 254)
Name: NF11672_low_22
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 44458923 - 44459040
Alignment:
| Q |
122 |
tgtgaaaggcaaacataaaacaaaaacaaaacctagccacttgtccccattcgattctctttgactcaccactttatgatggcgtttgcaagacatggca |
221 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44458923 |
tgtgaaagccaaacatcaaacaaaaacaaaacctagccgcttgtccccattcgattctctctcactcaccactttatgatggcgtttgcaagacatggca |
44459022 |
T |
 |
| Q |
222 |
ggaattgcatgattagat |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44459023 |
ggaattgcatgattagat |
44459040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 44466456 - 44466573
Alignment:
| Q |
122 |
tgtgaaaggcaaacataaaacaaaaacaaaacctagccacttgtccccattcgattctctttgactcaccactttatgatggcgtttgcaagacatggca |
221 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466456 |
tgtgaaagccaaacatcaaacaaaaacaaaacctagccgcttgtccccattcgattctctctcactcaccactttatgatggcgtttgcaagacatggca |
44466555 |
T |
 |
| Q |
222 |
ggaattgcatgattagat |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44466556 |
ggaattgcatgattagat |
44466573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 185 - 236
Target Start/End: Original strand, 46358669 - 46358720
Alignment:
| Q |
185 |
actcaccactttatgatggcgtttgcaagacatggcaggaattgcatgatta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46358669 |
actcaccactttatgatggcgtttgcaagacatggcaggaattgcatcatta |
46358720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University