View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_low_23 (Length: 253)
Name: NF11672_low_23
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 66 - 242
Target Start/End: Original strand, 42319745 - 42319921
Alignment:
| Q |
66 |
agttacagcgttcgcatcccgccactgcaattcgatgcgcttcctcagcttcagattctgggaacaacaaagtatcctctcggctttcgcaggtccatga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42319745 |
agttacagcgttcgcatcccgccactgcaattcgatgcgcttcctcagcttcagattctgggaacaacaaagtatcctctcggctttcgcaggtccatga |
42319844 |
T |
 |
| Q |
166 |
gcttctccaagaagctgaacatcgatctctctccgctgattacaacgccccaattcctaaaatcactttgggtctgt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42319845 |
gcttctccaagaagctgaacatcgatctctatccgctgattacaacgccccaattcctaaaatcactttgggtctgt |
42319921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University