View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11672_low_40 (Length: 202)
Name: NF11672_low_40
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11672_low_40 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0790 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 20 - 63
Target Start/End: Original strand, 2818 - 2861
Alignment:
| Q |
20 |
atcagttttgcaaagtaaagaggcttcaagattgtgagaggttt |
63 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2818 |
atcagttttacaaagtaaagaggcttcaagattgtgagaggttt |
2861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University