View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11673_low_5 (Length: 280)
Name: NF11673_low_5
Description: NF11673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11673_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 82 - 194
Target Start/End: Original strand, 5502309 - 5502421
Alignment:
| Q |
82 |
gattaaatcaagcatcgaaagatttgttattttctacaataatacatattagtggacaaaaataactatttaattctgatccttgaatatgtgtgacatt |
181 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5502309 |
gattaaatcaaacatcgaaagatttgttattttctacaataatacatattagtggacaaaaataactatttaattctgatccatgaatatgtgtgacatt |
5502408 |
T |
 |
| Q |
182 |
actgttcttgaat |
194 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5502409 |
actgttcttgaat |
5502421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 219 - 270
Target Start/End: Original strand, 5502420 - 5502471
Alignment:
| Q |
219 |
atatgtttatgtgtttctttaattaattattttagttctcgtcctcgttctt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5502420 |
atatgtttatgtgtttctttaattaattattttagtcctcgtcctcgttctt |
5502471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University