View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11675_high_15 (Length: 233)
Name: NF11675_high_15
Description: NF11675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11675_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 44 - 212
Target Start/End: Original strand, 46245977 - 46246145
Alignment:
| Q |
44 |
gagagagtgagggtaaaaagggaattttagcgagtacaaaatctagaggcagtgtggtttccacccacaagagcaacacgattaatttgcaaagaagacc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46245977 |
gagagagtgagggtaaaaagggaattttagcgagtgcaaaatctagaggcagtgtggtttccacccacaagagcaacacgattaatttgcaaagaagacc |
46246076 |
T |
 |
| Q |
144 |
aaagtgtcattaactccttcatacgttgaaactccattttattcaaagtggggcccaattcgatgatgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46246077 |
aaagtgtcattaactccttcatacgttgaaactccattttattcaaagtggggcccaattcgatgatgt |
46246145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University