View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11675_low_17 (Length: 211)
Name: NF11675_low_17
Description: NF11675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11675_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 125 - 172
Target Start/End: Original strand, 22437914 - 22437961
Alignment:
| Q |
125 |
taaataatttagctttgaatgggcaattggctatgcaatgtgaagtgt |
172 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
22437914 |
taaataatttagttttgaatgggcaattggctatgcaatgtgaggtgt |
22437961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 75 - 167
Target Start/End: Original strand, 22439904 - 22439998
Alignment:
| Q |
75 |
attcggaatagataagatacccagctcttcagatcattcatctaactagttaaataattta-----gctttgaatgggcaattggctatgcaatgtga |
167 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||||| ||||||||||||||||| | ||||||| | |||||||||||||||||||| |
|
|
| T |
22439904 |
attcggaatagataagacacc-agctctt--gatcattcatctcactagttaaataatttaaattagttttgaatcgccaattggctatgcaatgtga |
22439998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 22449392 - 22449356
Alignment:
| Q |
129 |
taatttagctttgaatgggcaattggctatgcaatgt |
165 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22449392 |
taatttagttttgaatgggcaattggctatgcaatgt |
22449356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University