View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11675_low_7 (Length: 323)
Name: NF11675_low_7
Description: NF11675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11675_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 12 - 303
Target Start/End: Original strand, 36521212 - 36521503
Alignment:
| Q |
12 |
atgaataaaaggagtggtggcagggtctccatgccatgcatcagccatgagacactgtcgtttagttttctttctgaccattggattttttaaacatcaa |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36521212 |
atgaataaaaggagtggtggcggggtctccatgccatgcatcagccatgagacactgtcgtttagttttctttctgaccattggatttgttaaacatcaa |
36521311 |
T |
 |
| Q |
112 |
aatccagtgatgacttcctcaatgttgagcttgtttgcatgggccctacctcgtgcccttctggataaatgattaatttgaattttggatgtagtacact |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36521312 |
aatccagtgatgacttcctcaatgttgagcttgcttgcatgggccctacctcgtgcccttctggataaatgattaattggaattttggatgtagtacact |
36521411 |
T |
 |
| Q |
212 |
acaatgtttttaaggtaaactctttagtaatgaaaagaattttatcagcttataagggtaaatattggacgtcattgtattcatattgtggt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36521412 |
acaatgtttttaaggtaaactctttagtaatgaaaagaattttatcagcttataagggtaaatattggtcgtcattgtattcatattgtggt |
36521503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University