View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11675_low_9 (Length: 285)
Name: NF11675_low_9
Description: NF11675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11675_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 75 - 202
Target Start/End: Original strand, 14003232 - 14003359
Alignment:
| Q |
75 |
ggatgaattttcctgatcggatatgaataaagttgttttgatgaaataacgtatcaattcagtgtgtgatataatgatatcaaattgaagtagtgttaac |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003232 |
ggatgaattttcctgatcggatatgaataaagttgttttgatgaaataacgtatcaattcagtgtgtgatataatgatatcaaattgaagtagtgttaac |
14003331 |
T |
 |
| Q |
175 |
atgaacaactacaactagttgtcatcct |
202 |
Q |
| |
|
|||||||| |||||||| |||||||||| |
|
|
| T |
14003332 |
atgaacaattacaactatttgtcatcct |
14003359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University