View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11676_low_3 (Length: 329)
Name: NF11676_low_3
Description: NF11676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11676_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 30567379 - 30567134
Alignment:
| Q |
18 |
ctcatgaaatggtaggttttcaaatatggttgtacattttcgattgttcaaataatagtccccttcaaaaaactccttttagaaaactttatgcccttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30567379 |
ctcatgaaatggtaggttttcaaatatggttgtacattttcggttgttcaaataatagcccacttcagaaaactccttttagaaaactttatgcccttat |
30567280 |
T |
 |
| Q |
118 |
atttatactttcacccttacatctattttacccacctatataaagttataaaatctctttcacataatcgataaaacatattgcaaccaacacgtgcttg |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30567279 |
atttatacgttcacccttacatctattttacccacctatataaagttataaagtctctttcacataatcgataaaacatattgcaaccaacacatgcttg |
30567180 |
T |
 |
| Q |
218 |
cttagacttttgcaaccattactgacactccacctcattaggagat |
263 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
30567179 |
cttagacttttacaaccattattgacactccacctcattaggagat |
30567134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University