View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11677_high_2 (Length: 290)
Name: NF11677_high_2
Description: NF11677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11677_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 7500864 - 7500586
Alignment:
| Q |
1 |
taataaatattcatttgctgcttaaagaaaactcccttcacccatcatgaataatttcagtaggttagatccagacatcatccagacctatatccttcca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500864 |
taataaatattcatttgctgctaaaagaaaactcccttcacccatcatgaataatttcagtaggttagatccagacatcatccagacctatatccttcca |
7500765 |
T |
 |
| Q |
101 |
cgcctcgatggggcagccttaatggcattgtcctgtgtatgttctgaccttcgccacttgatctgcaacaacgaggaattatggcggaacatttgcacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500764 |
cgcctcgatggggcagccttaatggcattgtcctgtgtatgttccgaccttcgccacttgatctgcaacaacgaggaattatggcggaacatttgcacct |
7500665 |
T |
 |
| Q |
201 |
ccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttcatctc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7500664 |
ccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttcttctc |
7500586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 81
Target Start/End: Original strand, 8057200 - 8057240
Alignment:
| Q |
41 |
cccatcatgaataatttcagtaggttagatccagacatcat |
81 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8057200 |
cccatcatgaataatttcagtaggttatgtccagacatcat |
8057240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 279
Target Start/End: Complemental strand, 7502118 - 7502019
Alignment:
| Q |
180 |
tatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttcatctc |
279 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||| |||| || |||||| ||||| | | | ||| |||||||||| ||||||||| |||| ||| |||| |
|
|
| T |
7502118 |
tatggcggaatatttgcacctcaaagtggccttcccttatggatccaatcgttaacgatgtcatctccactttccccggtggttacagttcattcttctc |
7502019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 212
Target Start/End: Original strand, 27240723 - 27240882
Alignment:
| Q |
56 |
ttcagtaggttagatccagacatcatccagacctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttctgaccttcgcc |
155 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| | |||||||| |||||||| || || ||||||| | || | || ||||||||| || || || | |
|
|
| T |
27240723 |
ttcagtaggttagatccagacatcatgcatacccacatccttccccgcctcgacggcacaaccttaatcgtcttattctctgtatgttcagaactccgtc |
27240822 |
T |
 |
| Q |
156 |
acttgatctg---caacaacgaggaattatggcggaacatttgcacctccatgtggcctt |
212 |
Q |
| |
|
|| |||| || ||||||||| || ||||||||||||| |||||||| | |||||||| |
|
|
| T |
27240823 |
acatgatttgccacaacaacgaagatctatggcggaacatatgcacctcaaagtggcctt |
27240882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 131 - 198
Target Start/End: Original strand, 27253110 - 27253177
Alignment:
| Q |
131 |
tcctgtgtatgttctgaccttcgccacttgatctgcaacaacgaggaattatggcggaacatttgcac |
198 |
Q |
| |
|
|||||||||| ||| || || |||||| |||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
27253110 |
tcctgtgtatcttcagaactccgccacatgatctgcaacaacgaagatctatggcggaacatatgcac |
27253177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University