View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11677_low_3 (Length: 276)
Name: NF11677_low_3
Description: NF11677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11677_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 28119229 - 28118965
Alignment:
| Q |
1 |
aatcatctctcttcttgaattgattatgaatttcatcccttacatctcaatcaatctacttacaacatattttaattaatattacggctacattacatat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119229 |
aatcatctctcttcttgaattgatgatggattacatcccttacatctcaatcaatctacttacaacatattttaattaatattacggctacattacatat |
28119130 |
T |
 |
| Q |
101 |
atat-----catcactcatcaacacagttagctataaaagttcaataatttcatcatcacaaaaaatactgattaatgtctcatcaacaaagtaatttgt |
195 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119129 |
atatattatcatcactcatcgacacagttagctataaaagttcaataatttcaacatcacaaaaaatactgattaatgtctcatcaacaaagtaatttgt |
28119030 |
T |
 |
| Q |
196 |
tagagacacaaacacatcctttgattctgtggggaactagcacatcgtaggacacttaggaaaag |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119029 |
tagagacacaaacacatcctttgattctgtggggaactagcacatcgtaggacacttaggaaaag |
28118965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University