View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11678_high_10 (Length: 253)
Name: NF11678_high_10
Description: NF11678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11678_high_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 18611738 - 18611496
Alignment:
| Q |
11 |
cacagaagtagggggcaattcacctccacacacaaaaatcttcttaagaaggaaagaaagtgattgattagaaacttcattcttattacttttatccaaa |
110 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18611738 |
cacagatgtaggtggcaattcacctccacacacaaaaatcttcttaagaaggaaagaaagtgattgattagaaacttcattcttattacttttatccaaa |
18611639 |
T |
 |
| Q |
111 |
ctctttcttcccctattgcatattaaattgttgcttggatagaaattaccactctcttccaaattcattttcaattcattctgaaaatttccaacttctt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18611638 |
ctctttcttcccctattgcatattaaattgttgcttggatagaaattaccactctcttccaaattcattttcaattcattctgaaaattcccaacttctt |
18611539 |
T |
 |
| Q |
211 |
caaaagagaactcatgtgtgaaatcttgaaaggagtatgaatc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18611538 |
caaaagagaactcatgtgtgaaatcttgaaaggagtgtgaatc |
18611496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University