View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11678_high_6 (Length: 464)
Name: NF11678_high_6
Description: NF11678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11678_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-171; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 140 - 456
Target Start/End: Complemental strand, 46795116 - 46794800
Alignment:
| Q |
140 |
gacttgttacaagatgtgtagcagtggaagaatgcaacaagaagaaattaggtaccctgggcctggtgcagattcaacaaatactcaacaaatgctgcaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795116 |
gacttgttacaagatgtgtagcagtggaagaatgcaacaagaagaaattaggtaccctgggcctggtgcagattcaacaaatactcaacaaatgctgcaa |
46795017 |
T |
 |
| Q |
240 |
caattgatgtcatcttcaacatcacctgctgatagtactgaaactgaggcttatgcaagatggcgtcagcttcttcaacttcagacctatagtaaccctt |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795016 |
caattgatttcatcttcaacatcacctgttgatagtactgaaactgaggcttatgcaagatggcgtcagcttcttcaacttcagacctatagtaaccctt |
46794917 |
T |
 |
| Q |
340 |
cttttcataatcatcataacctattggatagtgaaatacctagagatcatggtggatttaatgtgattgaggaatccattatgattaaaaggaacatgat |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46794916 |
cttttcataatcatcataacctattggatagtgaaatacctagagatcatggtggatttaatgtgattgaggaatccattatgattaaaaggaacatgat |
46794817 |
T |
 |
| Q |
440 |
gtctgctacttcatctc |
456 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
46794816 |
gtctgctacttcttctc |
46794800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 46795237 - 46795175
Alignment:
| Q |
19 |
tttccggcggtggtggcggtgatggtagttgttcttctaaagggagaaaattgaaatggacac |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795237 |
tttccggcggtggtggcggtgatggtagttgttcttctaaagggagaaaattgaaatggacac |
46795175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University