View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11678_low_12 (Length: 253)
Name: NF11678_low_12
Description: NF11678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11678_low_12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 253
Target Start/End: Original strand, 40576603 - 40576839
Alignment:
| Q |
16 |
tgaaaatactaacaaacaaaaaaggaaacattgaatctatatggtgaaccgtgcaccttatgattaattacgatcgagtctcatacatctgtcccat-tt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40576603 |
tgaaaatactaacaaacaaaaaaggaaacattgaatctat--ggtgaaccgtgcaccttatgattaattacgatcgagtctcatacatctgtcccatatt |
40576700 |
T |
|
| Q |
115 |
tatatttattcttcacttgcaattgctttcaatttgaatataatccatacaaaaataacttatacatgtcactaattacatataaaacatggacagaaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40576701 |
tatatttattcttcacttgcaattgctttcaatttgaatataatccatacaaaaataacttatacatgtcactaattacatataaaacatggacagaaag |
40576800 |
T |
|
| Q |
215 |
acattgacatgtttgaaataataacaaaaattacaattc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40576801 |
acattgacatgtttgaaataataacaaaaattacaattc |
40576839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University