View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11678_low_14 (Length: 208)
Name: NF11678_low_14
Description: NF11678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11678_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 52827123 - 52826947
Alignment:
| Q |
16 |
agacatggaaaaaggaagggagagggaaaaagcatatcccattatagtaacccttacccatacaaggttgaagattatattgtaggacagtttgcacaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52827123 |
agacatggaaaaaggaagggagagggaaaaagaatatcccattatagtaacccttacccatacaaggttgaagattatattgtaggacagtttgcacaat |
52827024 |
T |
|
| Q |
116 |
gcatgacaaaaactcgatgcaagggaatgagattggactgccctcttcattgtggtggaccatgttactatgattgt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52827023 |
gcatgacaaaaactcgatgcaagggaatgagattggactgccctcttcattgtggtggaccatgttactatgattgt |
52826947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 106 - 188
Target Start/End: Complemental strand, 7452879 - 7452797
Alignment:
| Q |
106 |
tttgcacaatgcatgacaaaaactcgatgcaagggaatgagattggactgccctcttcattgtggtggaccatgttactatga |
188 |
Q |
| |
|
||||||||||||||||||| ||| | ||||| || ||||| ||||| || |||||||| ||||||||||| |||| |||||| |
|
|
| T |
7452879 |
tttgcacaatgcatgacaagaacaaggtgcaaaggtatgaggttggattgtcctcttcactgtggtggaccttgtttctatga |
7452797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University