View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11679_low_4 (Length: 425)
Name: NF11679_low_4
Description: NF11679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11679_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 391; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 11 - 409
Target Start/End: Original strand, 29607088 - 29607486
Alignment:
| Q |
11 |
agagaagaaaacacaagcatagtaagcataagaaacatcacgcactagctctagcaccagagcctacaagttcaagttcaacaatcattaggaggagtcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607088 |
agagaagaaaacacaagcatagtaagcataagaaacatcacgcactagctctagcaccagagcctacaagttcaagttcaacaatcattaggaggagtcc |
29607187 |
T |
 |
| Q |
111 |
cccagcaccactggctgatgataatactacaatgagttcagatgaaggaccgtcaccagcacccagtcccagtgcggtaatatccttttccattttactt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29607188 |
cccagcaccactggctgatgataatactacaatgagttcagatgaaggaccgtcaccagcacccagtcccagtgcggtaatatctttttccattttactt |
29607287 |
T |
 |
| Q |
211 |
taagttacaattctatatttacggacctctttggtctggattatgccgcattaacgaattcatgcaatctttgtcatctgatctttatcagacagattgt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607288 |
taagttacaattctatatttacggacctctttggtctggatcatgccgcattaacgaattcatgcaatctttgtcatctgatctttatcagacagattgt |
29607387 |
T |
 |
| Q |
311 |
actctgacttggcaaaacttgctaaagcttcttttatcgaatcttatgattttatgtttcacagaatggtgcacaatcttaccaagggcaatggagaaa |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607388 |
actctgacttggcaaaacttgctaaagcttcttttatcgaatcttatgattttatgtttcacagaatggtgcacaatcttaccaagggcaatggagaaa |
29607486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University