View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1167_high_16 (Length: 251)
Name: NF1167_high_16
Description: NF1167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1167_high_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 3 - 251
Target Start/End: Original strand, 42092794 - 42093042
Alignment:
| Q |
3 |
aattaatttttatgatggtacaaagtccgtcttaaatttgttggacaccattattaatacctttcaacaactctaaccatgcaagtcctttttatagagt |
102 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092794 |
aattaatttttatgatggtacaaagtctgtcttaaatttgttggacaccattattaatacctttcaacaactctaaccatgcaagtcctttttatagagt |
42092893 |
T |
 |
| Q |
103 |
tgagttattatcgtattaagatggtttgcacaaaatagaaaatatactgaactcaaatttgaagaggcacatttgtttttattattattataatttgtcc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092894 |
tgagttattatcgtattaagatggtttgcacataatagaaaaaatactgaactcaaatttgaagaggcacatttgtttttattattattataatttgtcc |
42092993 |
T |
 |
| Q |
203 |
ttgcttgatatttatgctgtctcattactgggccctatgctactccact |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
42092994 |
ttgcttgatatttatgctgtctcattactgggccccatgcagctccact |
42093042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University