View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1167_low_16 (Length: 286)
Name: NF1167_low_16
Description: NF1167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1167_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 15 - 280
Target Start/End: Complemental strand, 46440230 - 46439965
Alignment:
| Q |
15 |
tatatacgagaaattaaggtggcagagtacagcggcgtacccttgccggagttagatcgggcggcgaaggtgttatgcttccgaagcttgccgagaccgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46440230 |
tatatacgagaaattaaggtggcagagtacagcggcgtacccttgccggagttagatcgggcggcgaaggtgttatgcttccgaagcttgctgagaccgt |
46440131 |
T |
 |
| Q |
115 |
tctccggccgagggccagcgacggtgtcgtcccacaactggtcgagaaggcccataaatggatcaggcgtattttagcagatgcggtgtatctgcgatcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46440130 |
tctccggccgagggccagcgacggtgtcgtcccacaactggtcgagaaggcccataaatggatcaggcgtattttagcagatgcggcgtatctgcgatcc |
46440031 |
T |
 |
| Q |
215 |
caatgaccagattccggtgtaagagatactactgcgactcattcatctcctatttaacgaagattt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46440030 |
caatgaccagattccggtgtaagagatactactgcgactcattcatctcctatttaacgaagattt |
46439965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University