View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1167_low_22 (Length: 251)
Name: NF1167_low_22
Description: NF1167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1167_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 178 - 241
Target Start/End: Complemental strand, 690250 - 690187
Alignment:
| Q |
178 |
atgtcttatttgggagtccaaactcctttctaaaatgggtcaagtggtctattaatgttctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
690250 |
atgtcttatttgggagtccaaactcctttctaaaatgggtcaagtggtctattaatgtcctctg |
690187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 48 - 122
Target Start/End: Complemental strand, 690382 - 690309
Alignment:
| Q |
48 |
ctcttctcacaacaaaaaacacgctcactcccaactgaactgctaaaatacccttgtgtgagttaagttacgcta |
122 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
690382 |
ctcttctcccaacaaaaaa-acgctcactcccaacagaactgccaaaatacccttgtgtgagttaagttatgcta |
690309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 690470 - 690422
Alignment:
| Q |
1 |
ttttgtagattggggtaaaatatttttagaagatattaaaaatgcgcct |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
690470 |
ttttgtagattggggtaaaatatttttagaagatattaaaaatgcgcct |
690422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 183 - 240
Target Start/End: Complemental strand, 37620095 - 37620038
Alignment:
| Q |
183 |
ttatttgggagtccaaactcctttctaaaatgggtcaagtggtctattaatgttctct |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
37620095 |
ttatttgggagtccaaactcctttctgaaatgggtcaagtggtctattaatgtcctct |
37620038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University