View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11680_low_11 (Length: 214)
Name: NF11680_low_11
Description: NF11680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11680_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 4e-43; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 17825440 - 17825348
Alignment:
| Q |
18 |
taaactgcatcaaggtgatgactggcatggctctgattcggttaaacagtggacttatgtcataggtaattatgtttcttaagcaaagaaact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17825440 |
taaactgcatcaaggtgatgactggcatggctctgattcggttaaacagtggacttatgtcataggtaattatgcttcttaagcaaagaaact |
17825348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 96
Target Start/End: Complemental strand, 17802318 - 17802241
Alignment:
| Q |
19 |
aaactgcatcaaggtgatgactggcatggctctgattcggttaaacagtggacttatgtcataggtaattatgtttct |
96 |
Q |
| |
|
||||| ||| ||||||| || |||||| | |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17802318 |
aaacttcatgaaggtgaagattggcatcacactgattcggttaaacactggacttatgtcataggtaattatgtttct |
17802241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 51 - 96
Target Start/End: Complemental strand, 17718190 - 17718145
Alignment:
| Q |
51 |
tgattcggttaaacagtggacttatgtcataggtaattatgtttct |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17718190 |
tgattcggttaaacactggacttatgtcataggtaattatgtttct |
17718145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 17814146 - 17814081
Alignment:
| Q |
22 |
ctgcatcaaggtgatgactggcatggctctgattcggttaaacagtggacttatgtcataggtaat |
87 |
Q |
| |
|
||||||||||||||||| |||||| | ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
17814146 |
ctgcatcaaggtgatgattggcatcacactgatacggttaaacattggacttatgtcataggtaat |
17814081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 51 - 96
Target Start/End: Complemental strand, 17854923 - 17854878
Alignment:
| Q |
51 |
tgattcggttaaacagtggacttatgtcataggtaattatgtttct |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17854923 |
tgattcggttaaacactggacttatgtcataggtaattatgtttct |
17854878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 17781321 - 17781253
Alignment:
| Q |
19 |
aaactgcatcaaggtgatgactggcatggctctgattcggttaaacagtggacttatgtcataggtaat |
87 |
Q |
| |
|
||||| ||| ||||||| || |||||| | |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17781321 |
aaacttcatgaaggtgaagattggcatcacactgattcggttaaacactggacttatgtcataggtaat |
17781253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 78
Target Start/End: Complemental strand, 17692875 - 17692819
Alignment:
| Q |
22 |
ctgcatcaaggtgatgactggcatggctctgattcggttaaacagtggacttatgtc |
78 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||||| |||||| ||||| |
|
|
| T |
17692875 |
ctgcatcaaggtgatgaatggcatcactctgattcagttaaacactggactcatgtc |
17692819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 95
Target Start/End: Complemental strand, 17821127 - 17821083
Alignment:
| Q |
51 |
tgattcggttaaacagtggacttatgtcataggtaattatgtttc |
95 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
17821127 |
tgattcggttaaacattggacttttgtcataggtaagtatgtttc |
17821083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 86
Target Start/End: Complemental strand, 17870439 - 17870403
Alignment:
| Q |
50 |
ctgattcggttaaacagtggacttatgtcataggtaa |
86 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17870439 |
ctgattcggttaaacactggacttatgtcataggtaa |
17870403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 88
Target Start/End: Complemental strand, 17923287 - 17923250
Alignment:
| Q |
51 |
tgattcggttaaacagtggacttatgtcataggtaatt |
88 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
17923287 |
tgattcggttaaacactggacttatgtcatgggtaatt |
17923250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 95
Target Start/End: Complemental strand, 17846046 - 17846002
Alignment:
| Q |
51 |
tgattcggttaaacagtggacttatgtcataggtaattatgtttc |
95 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
17846046 |
tgattcggttaaacactggactattgtcataggtaactatgtttc |
17846002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University