View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11681_high_8 (Length: 336)

Name: NF11681_high_8
Description: NF11681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11681_high_8
NF11681_high_8
[»] chr5 (2 HSPs)
chr5 (191-331)||(7907190-7907330)
chr5 (1-93)||(7907018-7907109)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 191 - 331
Target Start/End: Original strand, 7907190 - 7907330
Alignment:
191 tagttttgtgattggaaattggaaacaaatggcgatggcttcaatggcattctgtggtgtcaacacgatcaccttccagaaccgtgcccgatacaatagg 290  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||    
7907190 tagttttgtgattggaaattggaaacaaatggcgatgacttcaatggcattatgtggtgtcaacacggtcaccttccagaaccgtgcccgatacaatagg 7907289  T
291 taactcaaaattcatccaaacttgagccttttcttctctct 331  Q
    ||||||||||||||||||||||||||||||||||| |||||    
7907290 taactcaaaattcatccaaacttgagccttttcttttctct 7907330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 7907018 - 7907109
Alignment:
1 tttaccattttatatgtttgtgagggaagtctaaaattttgttaagtggaatatccgaatttccgcgggtaagaagagacaagaggataacaa 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7907018 tttaccattttatatgtttgtgagggaagtctaaaattttgttaagtggaatatccgaatttccgcgggtaag-agagacaagaggataacaa 7907109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University