View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11681_high_8 (Length: 336)
Name: NF11681_high_8
Description: NF11681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11681_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 191 - 331
Target Start/End: Original strand, 7907190 - 7907330
Alignment:
| Q |
191 |
tagttttgtgattggaaattggaaacaaatggcgatggcttcaatggcattctgtggtgtcaacacgatcaccttccagaaccgtgcccgatacaatagg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7907190 |
tagttttgtgattggaaattggaaacaaatggcgatgacttcaatggcattatgtggtgtcaacacggtcaccttccagaaccgtgcccgatacaatagg |
7907289 |
T |
 |
| Q |
291 |
taactcaaaattcatccaaacttgagccttttcttctctct |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7907290 |
taactcaaaattcatccaaacttgagccttttcttttctct |
7907330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 7907018 - 7907109
Alignment:
| Q |
1 |
tttaccattttatatgtttgtgagggaagtctaaaattttgttaagtggaatatccgaatttccgcgggtaagaagagacaagaggataacaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7907018 |
tttaccattttatatgtttgtgagggaagtctaaaattttgttaagtggaatatccgaatttccgcgggtaag-agagacaagaggataacaa |
7907109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University