View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11682_high_17 (Length: 319)
Name: NF11682_high_17
Description: NF11682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11682_high_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 31 - 319
Target Start/End: Original strand, 52987858 - 52988146
Alignment:
| Q |
31 |
aaactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987858 |
aaactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcat |
52987957 |
T |
 |
| Q |
131 |
gcataattgacgattcgatcgattcctttgaatagccctcattcttgcatcatggactaacttccctctcatttggaccctcacagccaccacacacaac |
230 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987958 |
gcataattgacgattctatcgattcctttgaatagccctcattcttgcaacatggactaacttccctctcatttggaccctcacagccaccacacacaac |
52988057 |
T |
 |
| Q |
231 |
aggcaatttggggcagtctgtacaagaatctttttctttctctgccggacttgaacaaccatgcatcgaggctaattcaacgtgctcgg |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988058 |
aggcaatttggggcagtctttacaagaatctttttctttctctgccagatttgaacaaccatgcatcgaggctaattcaacgtgctcgg |
52988146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University