View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11683_high_12 (Length: 239)
Name: NF11683_high_12
Description: NF11683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11683_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 113 - 223
Target Start/End: Complemental strand, 3675799 - 3675689
Alignment:
| Q |
113 |
tttgtcaatatttttaatccttatnnnnnnnttcatcaatatatttagtctctataaaattttcagtcagtgtttttatccctaaaaatgctaaaaattg |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3675799 |
tttgtcaatatttttaatccttataaaaaaattcatcaacatttttagtctctataaaattttcagtcagtgtttttatccctaaaaatgctaaaaactg |
3675700 |
T |
 |
| Q |
213 |
ttacatgtatt |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
3675699 |
ttacatgtatt |
3675689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University