View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11683_high_12 (Length: 239)

Name: NF11683_high_12
Description: NF11683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11683_high_12
NF11683_high_12
[»] chr6 (1 HSPs)
chr6 (113-223)||(3675689-3675799)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 113 - 223
Target Start/End: Complemental strand, 3675799 - 3675689
Alignment:
113 tttgtcaatatttttaatccttatnnnnnnnttcatcaatatatttagtctctataaaattttcagtcagtgtttttatccctaaaaatgctaaaaattg 212  Q
    ||||||||||||||||||||||||       |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
3675799 tttgtcaatatttttaatccttataaaaaaattcatcaacatttttagtctctataaaattttcagtcagtgtttttatccctaaaaatgctaaaaactg 3675700  T
213 ttacatgtatt 223  Q
    |||||||||||    
3675699 ttacatgtatt 3675689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University