View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11683_high_7 (Length: 257)
Name: NF11683_high_7
Description: NF11683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11683_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 33276993 - 33277238
Alignment:
| Q |
1 |
aaagagtttgctgagaaattgaaccgtgatgcacaagaacaactttctgggtttgatttgaataaagctgctcctttgattgctttggctaattacattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33276993 |
aaagagtttgctgagaaattgaaccgtgatgcacaagaacaactttctgggtttgatttgaataaatctgctcctttgattgctttggctaattacattg |
33277092 |
T |
 |
| Q |
101 |
cttataggcaaaactagatttgttttgtttattgttgtaatcttaaattattaaacagtttaggagatttagatttgtttatctattggggaatgtataa |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33277093 |
cttataggcaaaactagatt-gttttgtttattgttgtaatgttaaattattaaacagtttaggagatttagatttgtttatctattggggaatgtataa |
33277191 |
T |
 |
| Q |
201 |
aataattgttgaattatttccccttttcaatgtgtttttgcgttcat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33277192 |
aataattgttgaattatttccccttttcaatgtgtttttgtgttcat |
33277238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University