View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11683_low_1 (Length: 534)
Name: NF11683_low_1
Description: NF11683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11683_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 2e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 15 - 163
Target Start/End: Complemental strand, 3675963 - 3675805
Alignment:
| Q |
15 |
cagagaacgaataagagaattcatgtaaaatgttttcaacaatcaaatcactagtctgta----------taaacttgtacttctattagcttttggtag |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3675963 |
cagagaacgaatatgagaattcatgtaaaatgttttcaacaatcaaatcactagactgtaccaatgtggataaacttatacttctattagcttttggtag |
3675864 |
T |
 |
| Q |
105 |
aattgaagaacaaacccaagtttttcaaacaaacttatctcattttgacatagcctcta |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675863 |
aattgaagaacaaacccaagtttttcaaacaaacttatctcattttgacatagcctcta |
3675805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University