View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11683_low_10 (Length: 250)
Name: NF11683_low_10
Description: NF11683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11683_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 7026217 - 7026440
Alignment:
| Q |
12 |
agagatcaatgcttctatgaattaaaaacagttcagttatttctgttgcctgttttacttgcatgctttaaatgtgttaaggtaaattggaacatgaatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7026217 |
agagatcaatgcttctatgaattaaaaacagttcagttatttctgttgcctgttttacttgcatgctttaaatgtgttaaggtaaattggaacatgaatt |
7026316 |
T |
 |
| Q |
112 |
tgattgaataatagcccttgtggcagcttgtattgctatgaagtaagtttatgtggcttttgtaaacnnnnnnnccatccttattgttttgtctcagaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7026317 |
tgattgaataatagcccttgtggcagcttgtattgctatgaagtaagtttatgtggcttttgtaaactttttttccatccttattgttttgtctcagaat |
7026416 |
T |
 |
| Q |
212 |
tcagaaaatttctagagatgcatg |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7026417 |
tcagaaaatttctagagatgcatg |
7026440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University